ProtocolsIVTT Pipeline

MASTER_SOP - IVTT + TR-FRET (HTRF) Fast-Lane Binder Validation

Standard operating procedure from the WeaveSeq experiments team, shared across the IVTT pipeline runs.

MASTER_SOP - IVTT + TR-FRET (HTRF) Fast-Lane Binder Validation

Purpose: One bench protocol: top ~96 computationally ranked AffiniBind binder candidates (51-80 AA, mean 66.7, ~6-9 kDa) from amplified template to single-point TR-FRET screen, plus 12-point Kd titrations for the top 12 hits, run by one technician. All work is BSL-1.

When to use: A ranking round has produced a candidate table (candidate IDs and sequences). Screen-only (hit/no-hit) = 2 bench days; screen + Kd = 4 bench days. End-to-end from sequence order ≈ 6-8 calendar days (plan 8-10 with contingencies).

Companion protocols: Design rationale: SOP 01 decisions and criteria · SOP 02 materials and storage · SOP 03 template design · SOP 04 IVTT · SOP 05 plate assay · SOP 06 reader · SOP 07 analysis · appendix catalog numbers. Every number needed to run the assay is in this SOP.

2. PREREQUISITES & MATERIALS CHECKLIST

Check off before starting. Steps reference materials by the name in column 1. Confirm catalog numbers and pack sizes with the vendor at order time.

#	Item (name used in steps)	Vendor	Cat#	Qty	Used in steps
M1	gBlocks: 96 binder fragments, E. coli MFC codon-optimized	IDT	custom	96 tubes, 250-1,000 ng each	2, 7, 8, 9, 10, 11
M2	Control gBlocks: POS1 FLAG-core-streptavidin (~540 bp), CTRL FLAG-eGFP (~870 bp), spare POS1	IDT	custom	3 tubes	2, 16, 18
M3	Universal primer pair (F = T7, R = rev-comp terminator), 25 nmole	IDT	custom	1 pair	2, 9, 12
M4	Q5 2× Master Mix	NEB	M0492	1	9
M5	DNA Clean & Concentrator-5	Zymo	D4013	1 kit	10
M6	Qubit dsDNA HS Assay Kit	Thermo	Q32851	1	10
M7	10 mM Tris pH 8.0 (IDTE) resuspension buffer	IDT	custom	1	7
M8	UltraPure DNase/RNase-free water	Thermo	10977015	500 mL	7, 9, 10, 15, 21
M9	Sanger amplicon sequencing	core facility	-	12-20 rxns	12
M10	PURExpress In Vitro Protein Synthesis Kit, 10 rxn × 25 µL	NEB	E6800S	1 (pilot only)	3, 14
M11	PURExpress In Vitro Protein Synthesis Kit, 100 rxn × 25 µL	NEB	E6800L	1 per campaign	3, 15, 21
M12	PUREfrex 2.0 kit (Sol I/II/III + DHFR control)	GeneFrontier/Cosmo Bio	PF201-0.25-EX	6 kits (backup/lean option)	3, backup
M13	PUREfrex 2.1 (disulfide-forming variant)	GeneFrontier	PF213-0.25-EX	1 (contingency only)	8
M14	PURExpress Disulfide Bond Enhancer	NEB	E6820S	1 (contingency only)	8
M15	96-well full-skirt PCR plate	Axygen / Eppendorf	PCR-96-FS-C / 0030128648	2	15, 16, 21
M16	MicroAmp Clear Adhesive Film	Thermo	4306311	1 pkg	17, 20, 23
M17	Aluminum foil seals	VWR	60941-126	1 pkg	alternative sealing
M18	Mini PCR plate spinner	Labnet	MPS 1001	1 (skip if a plate-rotor centrifuge is available)	17, 19
M19	HTRF anti-FLAG M2-Tb cryptate donor, 20,000 tests	Revvity	61FG2TLB	1 vial	4, 20, 23
M20	HTRF Streptavidin-XL665 acceptor, 20,000 tests	Revvity	610SAXLB	1 vial	4, 20, 23
M21	HTRF detection buffer (HEPES/EDTA/KF)	Revvity	62SDBRDF (200 mL); small pack 62SDBRDD (40 mL)	1	4, 19, 20, 22, 23
M22	384-well small-volume white flat-bottom plate, case of 40	Greiner	784075	1 case	4, 20, 23
M23	Biotin-FLAG peptide (biotin-DYKDDDDK)	NovoPro	319196	1	4, 20, 23
M24	FLAG peptide DYKDDDDK	Sigma	F3290	4 mg	4, 18, 23
M25	MonoRab anti-DYKDDDDK [HRP]	GenScript	A01869	40 µg	4, 18
M26	Biotinylated target (sulfo-NHS-LC-biotin, 1-3 biotins/protein)	per antigen-prep SOP	-	pre-existing	20, 22, 23
M27	Homebrew detection-buffer reagents (optional): HEPES H3375, BSA A-420, Tween-20 P9416, KF, EDTA, Triton X-100 T8787, DTT DTT25	Sigma / GoldBio	as listed	optional	20
M28	PBS tablets	Sigma	P4417	100 tabs	18
M29	Nitrocellulose + ECL substrate + imager	lab stock	-	-	18
M30	DNA LoBind 1.5 mL tubes	Eppendorf	022431021	250	10, 22, 23
M31	Safe-Lock 1.5 mL tubes	Eppendorf	022363204	500	general
M32	Racked universal 200 µL tips	United Scientific	P10148	2 boxes	general
M33	25 mL V-bottom reagent reservoirs	Axygen	14222430	1 case	20, 23
M34	96-well intermediate dilution plate	-	-	2	19, 20
M35	HTRF-certified plate reader (facility instrument)	facility	-	2 × 2 h blocks	5, 20, 24
M36	Mirror-orientation fallback pair: Streptavidin-Tb + anti-FLAG-d2	Revvity	610SATLB + 61FG2DLB	optional	fallback

3. DAY 0: ORDERING + FACILITY BOOKING (steps 1-6)

Step 1: Select the campaign set. From the candidate table, take the top ~96 binders by ranking (candidate ID + sequence). First campaign only: pick 3-4 of these for the pilot (step 14).

Step 2: Order template DNA. Order 96 binder gBlocks (M1) + 3 control gBlocks (M2) + the universal primer pair (M3) from IDT, tubes format. Fragments ≤750 bp ship in 2-4 business days at 250-1,000 ng each. Median synthesis error 1:5,000 bp: expect ~6/96 fragments with ≥1 error. The single-point screen tolerates this; the dose-response set must be Sanger-clean (step 12). Backups: Twist (2-4 business days), GenScript (5-7 business days).

Construct each fragment 5′→3′: T7 promoter TAATACGACTCACTATAGGG + GG + SD AGGAGG + Kozak GCCACC + ATG + FLAG GACTACAAAGACGATGACGACAAG + E. coli-MFC CDS + double stop TAATAG + GTCGAC + T7 terminator TAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG. Total 273-360 bp (mean 320).

E. coli MFC codon table (zero rare codons): A=GCG, C=TGC, D=GAT, E=GAA, F=TTT, G=GGC, H=CAT, I=ATT, K=AAA, L=CTG, M=ATG, N=AAC, P=CCG, Q=CAG, R=CGT, S=AGC, T=ACC, V=GTG, W=TGG, Y=TAT.

Never build templates from a yeast codon-optimized library: AGA/AGG severely depress and frameshift E. coli translation.

Step 3: Order IVTT kits. PURExpress E6800L (M11) for the campaign, plus E6800S (M10) if the pilot (step 14) is pending; US overnight delivery. Order PUREfrex 2.0 (M12) in parallel as a backup and lean-scale option (Japan, ~1 week lead). Disulfide contingency kits (M13, M14) only if Cys-paired binders survive the design filters.

Step 4: Order detection reagents (first campaign only). Order the detection reagents and positive controls (M19-M25), the universal primers (M3), the plate spinner (M18, skip if a plate-rotor centrifuge is available), and reader access and training. One stock supports ~24-32 campaigns (buffer-limited at 10,000 wells).

Step 5: Book the facility reader. Confirm the HTRF optics: excitation 320-340 nm (337 nm); dual emission 620 + 665 nm; time-gated 50-100 µs delay, 400-600 µs integration; top read; white low-volume 384 plates; raw 620/665 RFU per well exported. Confirm the HTRF Reader Control Kit (RCK) DeltaF high/low calibrator check is current.

Certified models: Revvity EnVision 2103/2104/2105/Nexus; BMG PHERAstar FSX; VICTOR Nivo 5S/5F only (not 3S/3F); CLARIOstar / CLARIOstar Plus (filter configuration only); Tecan Spark (filter optics); Infinite M1000 PRO; SpectraMax iD5 (Enhanced TRF cartridge); Agilent Synergy Neo2; BioTek Synergy H1; legacy Victor X4/X5 also run HTRF.

Reader access and training: 1-2 weeks (self-use) or 2-4 weeks (staffed). Reserve 2 × 2 h blocks on separate days (screen day, Kd day); hold tentatively, confirm only after step 18 QC passes.

Step 6: Receipt QC. IVTT kit: −80 °C within 1 h of dry-ice arrival; 24-month shelf life; ≤5 freeze-thaws; keep a written freeze-thaw log for Solutions A/B and record the lot. Conjugates: lyophilized, 2-8 °C (bulk 610SAXAC format frozen below −60 °C); log vial lots + reconstitution dates. Verify the Greiner 784075 case is white, flat-bottomed. Re-confirm the reader booking.

4. DAY 1: TEMPLATE PREPARATION (steps 7-12)

Step 7: Resuspend gBlocks (M1, M2). Centrifuge each tube 10 s. Resuspend in 10 mM Tris pH 8.0 (M7) to ~10 ng/µL, pipetting up/down 10×. If a pellet remains: heat 55 °C 5 min, vortex, spin down. Equilibrate 30 min at room temperature. Store at −20 °C in DNA LoBind tubes (M30), ≤3 freeze-thaws. ~40 min per batch. QC: no visible pellet; ~10 ng/µL.

Step 8: In-silico QC of all 96 fragments (hard gate, before PCR). (1) All 96 translate in frame, ORF = M-DYKDDDDK-(binder)-STOP, 0/96 frame or premature-stop errors; (2) FLAG 96/96 immediately after ATG; (3) double stop TAATAG 96/96 before the 3′ spacer; (4) rare-codon scan AGG/AGA/CGG/CGA/ATA/CTA/CCC/GGA/TTA = 0 hits; (5) internal T7 promoter/terminator motifs in the CDS = 0 hits; (6) length 273-360 bp. All six must pass for all 96 before PCR proceeds. On receipt, diff the order manifest against the template table: 99/99 sequences match.

Step 9: Universal PCR. One primer pair (M3) amplifies all 96 fragments + controls. F = T7 promoter TAATACGACTCACTATAGGG; R = reverse-complement T7 terminator CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTA. Reactions: 96 binders + 2-3 controls + 1 no-template control (NTC) in 96-well PCR plates (M15). Master mix per 50 µL:

Component	Per 50 µL well
Q5 2× Master Mix (M4)	25 µL
Universal F primer, 10 µM	2.5 µL
Universal R primer, 10 µM	2.5 µL
gBlock (1-10 ng)	variable
Nuclease-free water (M8)	to 50 µL

Cycling: 98 °C 30 s → 12-15 × [98 °C 10 s / 60 °C 15 s / 72 °C 30 s] → 72 °C 2 min → hold 4 °C. Use the minimum cycle count giving robust yield; extra cycles accumulate polymerase errors. ~1-1.5 h.

Step 10: Cleanup, quantitation, normalization. Clean with Zymo DCC-5 (M5); elute 20 µL nuclease-free water (M8). Quantitate with Qubit dsDNA HS (M6); A260/A280 = 1.8-2.0. Normalize every amplicon to a 100 ng/µL working stock in DNA LoBind tubes (M30), −20 °C, ≤3 freeze-thaws. IVTT dose: 100 ng per 10 µL reaction (step 15), equal to NEB's 250 ng/25 µL standard. Bank master stocks for repeat campaigns.

Step 11: Gel QC. Agarose 1.5-2%; single band at the expected size ±10% (~320 bp mean). Multiple bands: raise annealing to 62-65 °C, cut to 12 cycles, gel-purify the correct band.

Step 12: Sanger the dose-response set. Submit the top 12-20 binders (dose-response cohort + screen outliers) with universal primers (M3). Exact-match gate; a mismatch means re-ordering that fragment from the backup vendor, or excluding it from titration with a recorded reason. Submit today; results must be in hand before step 21.

5. DAY 2: IVTT EXPRESSION + SCREEN (steps 13-20)

Step 13: Thaw PURExpress (M10/M11). Solutions A and B from −80 °C; thaw on ice 10-15 min. Never at 37 °C; do not store long-term at −20 °C. Flick or pipette to mix; keep on ice between uses. Record lot + freeze-thaw count. (PUREfrex M12 Solutions I/II/III: same handling.)

Step 14: Pilot gate (first campaign only). Express 3-4 binders + POS1 + CTRL with 1 × E6800S (M10) before the full campaign. PASS = anti-FLAG dot blot positive (step 18 method) AND expression consistent with the 0.5-1 mg/mL expected yield. Do not start the full campaign on a failed pilot.

Step 15: Prepare IVTT mini-reactions (10 µL/well). One template-free master mix for 110 wells: 440 µL Solution A + 330 µL Solution B (7 µL/well).

Component	Per 10 µL well
Solution A	4 µL
Solution B	3 µL
Template DNA, 100 ng/µL (step 10)	1 µL (= 100 ng; range 10-400 ng)
Nuclease-free water (M8)	2 µL (NTC wells: 3 µL, no template)

Dispense 7 µL master mix + 1 µL template + 2 µL water per well in a 96-well PCR plate (M15). Below 100 ng/µL yield: concentrate or raise template volume, compensating with water (template ≤4 µL/well). Expected yield 0.5-1 mg/mL = 5-10 µg/10 µL ≈ 60-125 µM crude, 3-4 orders above the ~1-10 nM the assay needs. PUREfrex M12 recipe: Solution I 5 µL + Solution II 0.5 µL + Solution III 1 µL + template (~100 ng) + water to 10 µL.

Step 16: Plate layouts.

Plate 1 (screen IVTT)	Plate 2 (QC/controls IVTT)
b01-b96 row-major in ranked order: A1-A12 = b01-b12, B = b13-b24, C = b25-b36, D = b37-b48, E = b49-b60, F = b61-b72, G = b73-b84, H = b85-b96	A1-A4 = NTC; A5-A6 = POS1; A7-A8 = CTRL; A9-A12 = spare NTC; B-H empty (day 3: 12 × 25 µL re-expressions go here)

Step 17: Incubate. Seal (M16, or foil M17), pressing firmly around every well. Incubate 2 h at 37 °C, static, no shaking; 4 h maximum (over-incubation reduces yield through RNA decay). Incubator or thermal cycler with heated lid at 37-40 °C; keep the seal on throughout. Then: plate on ice 5 min; spin 1,000 × g for 2 min in the plate spinner (M18) to collect condensate and pellet aggregates. Proceed within ~1 h.

Step 18: Expression QC by anti-FLAG dot blot. Spot 1 µL of each reaction diluted 1:10 in PBS (M28) per binder, plus all Plate 2 controls, plus a FLAG-peptide titration (M24, e.g. 50/10/2 ng) as loading standard. Air-dry 10 min. Block: 3% BSA in PBS-T (PBS + 0.1% Tween-20, M27), 30-60 min at room temperature. Anti-FLAG-HRP (M25) 1:2,000-1:5,000 in block buffer, 1 h at room temperature. Wash 3 × 5 min in PBS-T. Develop with ECL (M29); image. Plan ~2.5-3 h.

PASS: clear signal above NTC in ≥80% of binder wells AND strong POS1/CTRL. Flag and exclude failing wells with a recorded reason. FLAG is N-terminal, so truncated products still light up; if truncation is suspected, Sanger the template. Book the facility slot (step 5) once QC passes.

Step 19: Dilute lysates. Dilute neat IVTT reactions in detection buffer (M21) to a final assay dilution of 1:25-1:50 (binder ≈ 1.2-5 µM in the well; 60-125 µM crude ÷ 25-50). Titration plates need the 1-10 nM regime: ~1:5,000-1:12,000 final (step 27). Lysate is 5 µL of the 20 µL final volume, so pre-dilute 4× more concentrated than the final (1:20 final = 1:5 pre-dilution). Prepare in the intermediate dilution plate (M34) after a plate spin (M18). Dilute all lysates identically, including NT, CTR-, and POS1. This doubles as buffer exchange; no purification needed (PURE-type lysates are colorless and defined). Use diluted lysate same-day on ice; overnight 4 °C only for confirmation re-reads of already-diluted samples. Never freeze-thaw diluted lysate for quantitative Kd data.

Step 20: Screen plate S1: setup, incubation, read. 384-well Greiner 784075 (M22); 20 µL final; 240 assay wells.

Conjugate 4× stocks (fresh per batch, in M21): anti-FLAG M2-Tb (M19) 4 nM → 1 nM final (vendor range 1-5 nM); Streptavidin-XL665 (M20) 160 nM → 40 nM final (~50 ng/well). Add separately in 5 µL; never premix the two conjugates.
2× target stock 400 nM in M21 → 200 nM final. Optional dual-concentration upgrade: 2× stocks at 40 nM and 1,000 nM → 20/500 nM finals on two plates.
Buffer moat first: 20 µL M21 into all unused wells (rows K-P).
Samples: 5 µL diluted lysate per well per the map; 5 µL buffer to POS and BUF wells (POS peptide comes next).
Target: 5 µL 400 nM 2× target to binder, NT, CTR-, and POS1 wells; 5 µL buffer to NEG, POS, dBk, aBk, and COMP wells. For POS: 5 µL 100 nM 2× biotin-FLAG peptide (M23).
Pre-incubate: seal (M16); 30-60 min at room temperature, dark.
Donor: 5 µL 4× M19 to all wells except dBk (buffer instead).
Acceptor: 5 µL 4× M20 to all wells except aBk (buffer instead). Final 20 µL everywhere.
Incubate: sealed, 1-2 h at room temperature, dark.
Read at the facility (settings in step 24), 1-3 h after conjugate addition; absolute maximum under 6 h plate-to-read.

Screen plate S1 map (rows A-H = binders, rep 1 in columns 1-12, rep 2 in columns 13-24; rows I-J = QC; rows K-P = buffer moat). Binder order is column-major within 8-binder blocks (b01, b09, b17, …), NOT the row-major order of IVTT Plate 1 (step 16):

     1    2    3    4    5    6    7    8    9   10   11   12 |  13   14   15   16   17   18   19   20   21   22   23   24
A   b01  b09  b17  b25  b33  b41  b49  b57  b65  b73  b81  b89 | b01  b09  b17  b25  b33  b41  b49  b57  b65  b73  b81  b89
B   b02  b10  b18  b26  b34  b42  b50  b58  b66  b74  b82  b90 | b02  b10  b18  b26  b34  b42  b50  b58  b66  b74  b82  b90
C   b03  b11  b19  b27  b35  b43  b51  b59  b67  b75  b83  b91 | b03  b11  b19  b27  b35  b43  b51  b59  b67  b75  b83  b91
D   b04  b12  b20  b28  b36  b44  b52  b60  b68  b76  b84  b92 | b04  b12  b20  b28  b36  b44  b52  b60  b68  b76  b84  b92
E   b05  b13  b21  b29  b37  b45  b53  b61  b69  b77  b85  b93 | b05  b13  b21  b29  b37  b45  b53  b61  b69  b77  b85  b93
F   b06  b14  b22  b30  b38  b46  b54  b62  b70  b78  b86  b94 | b06  b14  b22  b30  b38  b46  b54  b62  b70  b78  b86  b94
G   b07  b15  b23  b31  b39  b47  b55  b63  b71  b79  b87  b95 | b07  b15  b23  b31  b39  b47  b55  b63  b71  b79  b87  b95
H   b08  b16  b24  b32  b40  b48  b56  b64  b72  b80  b88  b96 | b08  b16  b24  b32  b40  b48  b56  b64  b72  b80  b88  b96
I   POS  POS  POS  POS  NEG  NEG  NEG  NEG  NT   NT   CTR  CTR | aBk  aBk  dBk  dBk  POS  POS  POS  POS  NEG  NEG  NEG  NEG
J   POS  POS  POS  POS  NEG  NEG  NEG  NEG  NT   NT   CTR  CTR | aBk  aBk  dBk  dBk  POS  POS  POS  POS  NEG  NEG  NEG  NEG
K-P BUF  BUF  BUF  BUF  BUF  BUF  BUF  BUF  BUF  BUF  BUF  BUF | BUF  BUF  BUF  BUF  BUF  BUF  BUF  BUF  BUF  BUF  BUF  BUF

Control legend (S1 and T1): POS = 50 nM biotin-FLAG + both conjugates, no lysate (maximal bridge signal; validates both conjugates and the full sandwich). POS1 = IVTT FLAG-core-streptavidin lysate + target + conjugates (end-to-end geometry). NEG = lysate + both conjugates, NO target (ratio and deltaF baseline). NT = no-DNA IVTT diluted identically + target + conjugates (lysate-only background). CTR- = FLAG-eGFP lysate + target + conjugates (must read ≈ NEG). aBk = POS peptide + donor only (donor bleedthrough). dBk = POS peptide + acceptor only (acceptor cross-excitation). COMP = POS + 100 µg/mL free FLAG peptide (M24) (must drop to ≈ NEG). BUF = buffer only.

6. DAY 3: DOSE-RESPONSE TITRATIONS + FACILITY READ (steps 21-24)

Step 21: Re-express the top 12 screen hits at 25 µL. Fresh Day 3 lysate in the empty rows of Plate 2: per well 10 µL Solution A + 7.5 µL Solution B + 250 ng template (step 10 stock) + water to 25 µL. Incubate and QC as steps 17-18 (12 × 25 µL = 300 µL; 12-25 µg per binder). Sanger result (step 12) in hand first; exclude any binder with an erroneous template. 13+ binders: second T1 plate.

Step 22: Prepare the 2× target master series. Serial 1:1.6 dilutions of biotinylated target (M26) in detection buffer (M21), LoBind tubes (M30), 13 tubes:

Tube	P1	P2	P3	P4	P5	P6	P7	P8	P9	P10	P11	P12	P13
2× (nM)	2000	1248	780	486	304	189.6	118.4	73.8	46.2	28.8	18.0	11.2	0 (buffer)
Final (nM)	1000	624	390	243	152	94.8	59.2	36.9	23.1	14.4	9.0	5.6	0

Optional 6,000 nM 2× top point (3,000 nM final) for suspected weak binders. Do not substitute a 3-fold series: 12 true 3-fold steps from 1,000 nM run off the bottom at 5.6 pM, below assay range. Brackets the expected 5-300 nM Kd window.

Step 23: Titration plate T1: setup, incubation. 384-well Greiner 784075 (M22): 12 binders × 13 points × 2 replicates = 312 binder wells + 32 QC + 16 BUF wells (rows N-O) + moat.

Moat first: 20 µL M21 in row P.
Target: 5 µL of the appropriate 2× point into every well of rows A-M; each 2-column binder block gets the full series top-to-bottom (P1 in row A to P13 in row M).
Binder lysates: 5 µL per well; b1 in columns 1-2, b2 in 3-4, through b12 in 23-24; both replicates. First titration of an unknown binder: two lysate dilutions (e.g. 1:1,000 and 1:5,000 final) on separate plates, since the 1:25-1:50 screen dilution leaves µM-range binder and risks depletion (step 19).
QC wells (rows N-O): POS ×8, NEG ×8, NT ×4, CTR ×4, aBk ×4, dBk ×4, BUF ×16, per the control legend (step 20). NT and CTR- get 5 µL 400 nM 2× target (200 nM final); POS gets 5 µL 100 nM biotin-FLAG (M23); COMP, if included, gets 5 µL 200 µg/mL 2× free FLAG (M24).
Pre-incubate 30-60 min at room temperature, dark, sealed (M16).
Conjugates: 5 µL 4× M19 to all wells except dBk; 5 µL 4× M20 to all wells except aBk (stocks from step 20).
Incubate 1-2 h at room temperature, dark, sealed.

        1 2 | 3 4 | 5 6 | 7 8 | 9 10 | 11 12 | 13 14 | 15 16 | 17 18 | 19 20 | 21 22 | 23 24
  A     P1 P1 (b1) | P1 P1 (b2) | ...                                                      (b12)
  B     P2 P2      | ...
  C     P3 ...     |   (P4..P12 in rows D-L)
  M     P13 P13 (0 nM blank)
  N-O   POS POS NEG NEG NT CTR aBk dBk BUF... (32 QC + 16 BUF across both rows)
  P     buffer moat

Keep critical points off the outer ring; both plates' QC wells sit in rows N-O (interior).

Step 24: Read at the facility. Settings template: 384-well white low-volume (M22), top read, 20 µL/well; excitation 337 nm laser or 320-340 nm UV flash; emission 620 nm donor + 665 nm acceptor (simultaneous dual emission if available); delay/integration per model: EnVision 50/400 µs, VICTOR Nivo (5S/5F only) 70/400, CLARIOstar (filter build) 60/400, Tecan Spark (filter) lag 100 µs / integration 400 µs (gain 80-220), Infinite M1000 PRO 60/500, SpectraMax iD5 (Enhanced TRF) 100/600, Synergy Neo2 150/500, PHERAstar FSX as certified. 30-200 flashes/well; endpoint reads only (no kinetics, no injectors). Export raw 620 and 665 RFU per well (plus computed ratio if offered) as CSV.

Transport: plates read as-is (no wash, no stop); covered or foil-wrapped, dark, room temperature, never on ice; the seal stays on until the read head is ready. Do not centrifuge the assay plate after the final incubation. Read 1-3 h after conjugate addition (hard max under 6 h), ≤5 min/plate (14 s flying mode on a PHERAstar); ~3 reads for a standard campaign. After the read, export the raw data for Day 4; do not use the reader's on-board curve fitting.

7. DAY 4: ANALYSIS + WEAVESEQ PUSH (steps 25-29)

Step 25: Compute ratios. Archive raw files unmodified; record plate ID, reader model, delay/integration settings, reagent lots, incubation time, operator. Then per well:

HTRF ratio R = (665 nm / 620 nm) × 10,000. Never fit raw 665 counts; the ratio compensates pipetting and mild interference. deltaF% = (R − R_NEG) / R_NEG × 100, where R_NEG is the plate's own NEG mean. Assay window (titration plates) = max ratio / min ratio.

Step 26: Plate QC gates, then call screen hits. Apply per plate; on fail, see Troubleshooting.

Gate	Pass	Fail →
Z′ (POS vs NEG, ≥4+4 wells; 8+8 recommended)	≥ 0.5 (0.4-0.6 acceptable with caution; do NOT hard-reject on Z′ alone)	flag, investigate control prep; re-read/repeat
Control CV (POS + NEG replicates)	≤ 10%	fix pipetting, repeat control block
POS bridge deltaF%	≥ 200%	conjugate problem; do not trust the plate
620 nm donor cps (donor-loading QC; not expression)	20,000-80,000 (accept ≥ 5,000); flag wells outside 0.5-2× donor-control median	donor dilution or reader-gain error
Assay window (titration plates)	≥ 3 (gate ≥ 2)	re-titrate wider range
NT & CTR- vs NEG	within ~2× of NEG ratio	lysate background; check dilutions, raise BSA/Tween
COMP (first plate of campaign)	drops to ≈ NEG	donor binds non-tagged material
Titration top points	P1 ≥ P3 (top points can hook from free-biotin competition for the fixed acceptor; exclude hooking P1/P2 from the fit)	exclude from fit

Well-level flags: exclude or down-weight a well if 620 cps is outside 0.5-2× the donor median, duplicate ratio deviation exceeds 30%, or 665 nm is above the aBk median + 5σ with 620 normal.

Screen hit call (mean of n=2): hit = R ≥ μ_NEG + 5σ AND deltaF% ≥ 50%; strong hit = deltaF% ≥ 100%. Rank by deltaF%; promote the top 12-20 plus design-priority binders to titration.

Step 27: Fit the quadratic 1:1 model. Geometry: fixed FLAG-binder, titrated biotinylated target; donor on binder, acceptor on target; signal rises with target. Model in total concentrations, B = free binder:

AB = [ (B + X + Kd) − sqrt( (B + X + Kd)² − 4·B·X ) ] / 2 ; Y = bg + S·AB

Midpoint = Kd + B/2 in the depletion regime; reduces to Langmuir when B ≪ Kd.

Analysis sequence: (1) import the CSV, compute R; (2) plate QC, then well QC; (3) fit the quadratic (always primary); (4) cross-check 4PL on log10(target), plus Langmuir when fitted B < Kd/3; (5) bootstrap 500-1,000 well resamples for the 95% CI on Kd; (6) apply the acceptance gates; emit the results table + per-binder curve plot. Weights: 1/y, or 1/y² for the 4PL cross-check.

Fit acceptance: n ≥ 8 points; ≥4 points within 3-fold of the fitted Kd; curve span (top/bottom) ≥ 1.5×; 95% CI span under 10-fold; R² > 0.9. Depletion flag: fitted B ≥ Kd/3 means the apparent Kd is an UPPER BOUND; re-run the lysate more dilute (step 19). Quantitative floor ~2-5 nM; tighter binders are reported as upper bounds. Flat curve (span < 1.5×) → report "Kd > 1 µM". Fitted B < 1 nM (only reachable in the 1-10 nM regime) → low-expression flag: retest with the 25 µL re-expression or drop.

Optional dual-concentration screen (ranking only): R = ratio(500 nM) / ratio(20 nM); apparent Kd ≈ C_hi·C_lo·(R−1)/(C_hi − R·C_lo). Valid only when binder ≪ Kd and 1 < R < 25; noise-sensitive, so triage only.

Step 28: Hit matrix and final report. Confirmed binder = fitted Kd ≤ 1 µM with all fit-acceptance gates met; strong = Kd ≤ 100 nM (priority for soluble-scale validation); weak = 1-3 µM; non-binder = "Kd > 1 µM". Flags for depletion and low expression. Merge onto the annotated candidate table (join on candidate_uid): per-candidate Kd, 95% CI bounds, fitted total binder concentration, depletion flag, screen deltaF%. Write the merged table + a human-readable CSV sorted by classification, then Kd. Report = per-binder fitted-curve PNG + the QC gate table (step 26) + the hit CSV + plate IDs and reagent lots.

Step 29: Record the campaign in WeaveSeq. One campaign-level screen entry + one titration entry per candidate, carrying plate ID, reader model and settings, QC metrics (Z′, control CV, assay window, POS deltaF%, donor 620 median cps, NEG mean ratio), and fit outputs (Kd, 95% CI, fitted binder concentration, R², curve span, depletion flag, target series).

8. TROUBLESHOOTING QUICK HITS

Escalation ladder (in order): re-read the plate → re-pipette affected wells → Sanger the template → re-express at 25 µL → re-order the fragment → drop with a recorded reason (drop only when two independent causes are excluded).

Single PCR fragment fails → likely the ~6% synthesis-error rate (1:5,000/bp) or a lost pellet. Re-spin, re-resuspend in M7, re-PCR. Still silent: re-order from the backup vendor; flag as excluded (template QC).
All PCR fails / multiple bands → check the F/R sequences (step 9) and the 60 °C anneal against primer Tm; raise annealing to 62-65 °C, cut to 12 cycles, gel-purify the correct band; replace the Q5 master mix (M4).
Plate-wide IVTT silence → kit exceeded ≤5 freeze-thaws or its 24-month shelf life, or wrong temperature. Check the lot log, thaw fresh aliquots, confirm 37 °C for 2 h (max 4 h); verify Solutions A AND B are both in the master mix; confirm DNA within 10-400 ng/10 µL; suspect RNase: nuclease-free water and filter tips.
Subset/single binder silent → rare codons (AGA/AGG, a yeast codon-optimization signature) or SD not 6-8 nt upstream of ATG; re-run the rare-codon scan, redesign the first 10-15 codons with the MFC table, re-order.
Ladder of truncation bands → frameshift/indel from a synthesis error or hidden stop; Sanger the template. Never trust screen results from an erroneous template.
Turbid lysate / no saturation at high lysate input → aggregation; dilute 1:25-1:50 into buffer (step 19), reduce lysate input, re-titrate more dilute. Cys-paired binder: M13 or M14 contingency.
No assay window (ratio ~flat) → run the POS biotin-FLAG bridge (M23) fresh. Dead conjugate or free-biotin poisoning: replace whichever conjugate restores signal. POS works but binders flat: check the dot blot and the fitted B (620 cps reports donor loading, NOT expression); verify target biotinylation (1-3 biotins/protein).
High lysate background → keep the final lysate share at ≤5-10% of volume; dilute 1:25-1:50; fresh tips per well; spin the IVTT plate (M18) before transfer. PURExpress and PUREfrex are colorless, lowest-background systems; never rabbit reticulocyte lysate (hemoglobin absorbs ~320-450 nm).
Edge-effect noise → fill the moat first, seal throughout incubation, keep critical titration points off the outer ring, keep incubations 1-2 h at room temperature.
Low Z′ / high control CV → pipetting imprecision, edge wells, evaporation; check control CV ≤ 10%, moat + seal, re-read. Small window: reagent concentrations or dead conjugate; check POS deltaF% ≥ 200%.
Bad Kd fits → midpoint shifting with dilution = depletion regime (B ≥ Kd/3); refit the quadratic with B free, re-run at ~1:5,000-1:12,000 final dilution (step 19). CI span ≥ 10-fold: check the series arithmetic (a 3-fold × 12-step series overshoots to pM; use the 1.6-fold series), add replicates, or re-center on the provisional Kd. Kd below ~2-5 nM with exploding CI = depletion floor; report an upper bound.
Reader wrong build → CLARIOstar/Spark monochromator configurations, VICTOR Nivo 3S/3F, and the iD5 without the Enhanced TRF cartridge are not HTRF-capable; request the filter-optics / 5S-5F / cartridge build. If only the computed ratio is exported, request raw 620/665 RFU per well (the donor QC gate needs it).